chapotraphouse

13813 readers

706 users here now

Banned? DM Wmill to appeal.

No anti-nautilism posts. See: Eco-fascism Primer

Slop posts go in c/slop. Don't post low-hanging fruit here.

founded 4 years ago

MODERATORS

[email protected]

122

So like... Is no one going to declare war on the rapidly unhinging, crumbling fascist empire that has openly admitted to basically wanting to expand its military and fuck the world? (hexbear.net)

submitted 3 weeks ago by [email protected] to c/[email protected]

111 comments fedilink hide all child comments

No? We just gonna sit around and let Nazi Germany 2.0 happen? Maybe waggle your finger a bit at them? Cool. Yeah. Okay. I love our leaders, they're so commited to the freedom and wellbeing of their people.

God I wish the Red Army was here to save our asses like last time.

you are viewing a single comment's thread
view the rest of the comments

[–] [email protected] 22 points 3 weeks ago (1 children)

I'm absolutely talking out of my butt now, but the US still has nukes and is OK with using them offensively. The best bet is to let a defensive war happen.

[–] [email protected] 10 points 3 weeks ago (1 children)

Okay do it again but this time talk out of your bidet

[–] [email protected] 8 points 3 weeks ago

AAGAUUUAGUUGAGGGUGGAGAGUGGGAGGGA